Skip to main content
Download PDF

Brachyury promotes proliferation and migration of colorectal cancer cells by targeting MMP14

Cancer Cell International volume 25, Article number: 132 (2025) Cite this article

Abstract

Background

The incidence and mortality rates of colorectal cancer (CRC) are rising, and it is the second most common cause of cancer-related deaths worldwide. Although the transcription factor, Brachyury is intricately linked with various clinical malignancies, the mechanisms by which it influences CRC cell proliferation and migration are inadequately understood.

Methods

Tissue microarray was used to evaluate Brachyury expression in CRC and adjacent normal tissues. The effects of Brachyury on HCT116 and SW480 CRC cells were also examined in vitro, including using Cell Counting Kit-8, colony formation, and transwell assays, and in vivo through subcutaneous tumorigenesis assays in a nude mouse xenograft model. Chromatin immunoprecipitation was used to evaluate Brachyury binding to the MMP14 promoter and its impact on MMP14 expression. Rescue experiments were used to elucidate MMP14’s role in mediating Brachyury’s effect on CRC cell behavior.

Results

Brachyury expression was significantly higher in CRC tissues than in adjacent normal tissues, and it promotes CRC oncogenesis in vitro and in vivo. Rescue experiments established MMP14 as a direct, downstream Brachyury target, affirming that MMP14 enhanced Brachyury-driven CRC cell proliferation.

Conclusion

Our findings highlight targeting the Brachyury–MMP14 axis as a potential novel approach for CRC clinical therapy.

Background

Colorectal cancer (CRC) is among the most common cancer types worldwide [1], and about 400,000 new CRC cases are diagnosed in China annually, significantly influencing public health outcomes [2, 3]. Early detection and diagnosis are critical in enhancing prognosis in patients with CRC. Precancerous polyps or early-stage cancer can be detected via screening procedures like colonoscopy and stool DNA tests, allowing for timely treatment [4]. Despite the widespread use of adjuvant therapy, the prognosis of patients with advanced CRC remains low [5]. Therefore, patient prognosis can be improved by understanding the molecular mechanisms of CRC metastasis, identifying new therapeutic targets, and developing more effective treatments.

Brachyury, also known as T-box transcription factor T (TBXT), is a transcription factor with a DNA-binding T-domain belonging to the T-box family. It controls the development of the posterior mesoderm and notochord by binding to highly conserved palindromic sequences in diverse organisms [6]. In various cancers, including chordoma [7], breast cancer [8], prostate cancer [9], and head and neck cancer, Brachyury expression correlates with tumor advancement, distant metastasis, survival rate, and prognosis [10]. Moreover, in CRC patients, research has linked Brachyury expression to more aggressive tumor characteristics and a worse prognosis [11]. However, the specific mechanisms underlying how Brachyury affects CRC cells have not been fully elucidated.

Matrix metalloproteinase-14 (MMP14), a member of the membrane-type matrix metalloproteinase family [12], has been identified as the primary protease responsible for endoglin shedding, via endoglin cleavage near the transmembrane domain at residue 586, which facilitates the release of endoglin’s full-length extracellular domain [13]. By facilitating the breakdown of cell adhesion molecules, breaching the basement membrane, and disrupting the extracellular matrix (ECM), MMP14 plays a significant part in tumor development and metastasis [14,15,16]. This mechanism allows cancer cells to break away from the primary tumor and infiltrate surrounding tissues. Additionally, during endogenous and exogenous angiogenesis processes, MMP14 is involved in ECM remodeling via the cleavage of ECM components and the release of growth factors and matrikines, which are critical for angiogenesis and cancer cell migration. MMP14 is also engaged in cytoskeleton reorganization via the cleavage and release of receptor protein tyrosine kinase, PTK7, and Wnt/planar cell polarity pathway activation, which is crucial for epithelial–mesenchymal transition. MMP14 is overexpressed in CRC tissues at the transcriptional and protein levels [15, 17], and is associated with advanced disease stages. The correlation between increased MMP14 levels and advanced tumor stage, as well as poor prognoses, underlines its prospective significance in precision therapy targeting. This highlights MMP14’s crucial role and potential therapeutic utility [15]. Previous studies indicate that MMP14 may promote proliferation and that it interacts with miR-2467-3p [18]. Taken together, MMP14 significantly contributes to cancer cell proliferation and aggressiveness by influencing cancer cell interactions with the surrounding microenvironment.

This study elucidated the intricate involvement of Brachyury in the complex landscape of CRC oncogenesis, including its elevated expression in CRC tissues and its contribution to tumor proliferation and migration in vitro and in vivo. We used chromatin immunoprecipitation (ChIP) to investigate the downstream pathways modulated by Brachyury, which formed the foundation for future investigations into the molecular mechanisms of CRC progression. Our findings enhance our understanding of Brachyury’s oncogenicity and are a pivotal step toward the identification of new therapeutic strategies against CRC.

Methods

Immunofluorescence

Paraffin-embedded tissues were sectioned at a 4–5 μm thickness, dewaxed with xylene, and rehydrated using an alcohol gradient, as described previously [19,20,21,22]. After antigen retrieval using a microwave oven, the sections were blocked in 1% bovine serum albumin for two hours and then incubated with primary antibodies overnight at 4 °C. Next, secondary antibodies (Thermo Scientific, Waltham, USA) were applied. All CRC samples were examined using confocal laser microscopy (LSM 800). The tissue CRC microarray was supplied by Zhongke Huaguang Biotech Co., Ltd. (Xi’an, China) and it was probed with an anti-Brachyury primary antibody (Abcam). All antibody information is listed in Table S1.

Cell culture

The CRC cell lines, HCT116 and SW480, were purchased from Zhong Qiao Xin Zhou Biotechnology Company (Shanghai, China). Cells were cultured in Dulbecco’s modified eagle medium (MeilunBio, Dalian, China) supplemented with 10% fetal bovine serum (TransSerum RQ fetal Bovine Serum, FS401-02, Beijing, China) and 1% penicillin/streptomycin (Invitrogen, Carlsbad, CA, USA). SiRNAs targeting Brachyury (si-BRY-1#: 5’-GCUGAACUCCUUGCAUAAG-3’ and si-BRY-2#: 5’-GCUUAUCAGAACGAGGAGA-3’) and MMP14 (si-MMP14-1#: 5’- GCAACAUAAUGAAAUCACU-3’ and si-MMP14-2#: 5’- GAUCUGAAUGGAAAUGACA-3), and a non-targeting control siRNA (si-NC: 5-UUCUCCGAACGUGUCACGU-3), were purchased from Tsingke (Beijing, China). The cells were transfected at a 60–70% confluence using the transfection reagents, Lipofectamine 2000 (Invitrogen) and X-tremeGENE HP DNA (Roche, Switzerland) and Opti-MEM (1x) Reduced Serum Medium (Gibco). The plasmids used in this study included pcDNA3.1-EV (empty vector), pcDNA3.1-Flag-Brachyury (BRY), and pcDNA3.1-Flag-MMP14, and were purchased from Sangon Biotech Inc., Shanghai, China. For downstream experiments, cells were harvested 48 h after transfection. All siRNAs and vectors were used at concentrations of 20 nM and 0.5 µg/mL, respectively.

Cell viability assay

SiRNA- or plasmid-transfected HCT116 and SW480 cells (2,500 cells/well) were seeded into 96-well plates. Using a standardized protocol [23,24,25,26], optical density was assessed using a CCK-8 kit (MCE) every 24 h for five days.

Colony formation assay

Transfected HCT116 and SW480 cells were seeded into six-well plates at a density of 500 cells/well and then cultured for two weeks with a culture medium change every seven days. Cell colonies were then fixed with methanol for 15 min and stained with 0.1% crystal violet (Beyotime) for 15 min, with excess crystal violet being gently rinsed off with PBS. The colonies were then dried and imaged.

Cell migration assay

After transfection for 48 h, 5 × 10⁴ HCT116 or SW480 cells were seeded in the upper chamber of 24-well plates containing 700 µl of serum-containing medium and 300 µl of serum-free medium in the lower and upper chambers, respectively. After incubation for 72 h, the cells that traversed the membrane were immobilized, stained, and photographed, as described previously [26,27,28].

Mouse xenograft

HCT116 cells that were stably transfected with the sh-BRY plasmid (constructed by GenePharma by cloning the si-BRY-1# sequence into lentiviral vector 3) or an empty vector. The cells were then diluted in PBS and injected into both axillary regions of five-week-old BALB/c nude mice (SPF level; n = 5). Tumor dimensions were measured using calipers every three days, until the twelfth day. To prevent an excessive physical burden on the mice, they were euthanized after 12 days, after which tumor volumes and weights were measured. Approval of the animal protocols was granted by the Animal Research Committee of Wuxi No. 2 People’s Hospital, affiliated with Nanjing Medical University.

ChIP analysis

For this analysis, a ChIP assay kit (Millipore, Billerica, MA, United States) was used as reported previously [8, 29, 30]. Briefly, cells were collected, rinsed, and fixed with 1% formaldehyde. Next, DNA–protein complexes were extracted and fragmented at lengths of 300–500 base pairs. Real-time PCR was used to analyze the immunoprecipitated DNA using the following primers: MMP14-F: 5’- GAGCCACAGATCCGGTATGG − 3’, MMP14-R: 5’- GGGAGAAGGGGCCAGTTTAC − 3’; GAPDH-F: 5’-TGGCATTGCCCTCAACGAC-3’, GAPDH-R: 5-TTTTCTGAGCCAGCCACCAGAG-3.

RNA extraction and qRT-PCR

RNA was extracted from CRC cells using RNA Isolater Reagent (Vazyme, Nanjing, China) using the manufacturer’s protocol and then converted into cDNA using a HiScript II Q RT SuperMix for qPCR kit (R323-01, Vazyme, Nanjing, China) following established protocols. For real-time PCR analysis, the synthesized cDNA was used as the template in a PCR system (Applied Biosystems, Foster City, CA, USA). BRY and MMP14 expression levels were determined using the 2ΔΔCT method. The following primers were used: MMP14-F: 5’-CCGATGTGGTGTTCCAGACA-3’, MMP14-R: 5’-TCGTATGTGGCATACTCGCC-3’, Brachyury-F: 5’-GCTGGACCAATTGTCATGGG-3’, and Brachyury-R: 5’-GGGTACTCCCAATCCTATTCTGAC-3’.

Dual-luciferase reporter assay

HCT116 and SW480 cells were transiently transfected with the pGL6 luciferase reporter plasmid, along with the OE-Brachyury effector plasmid. A Renilla luciferase-containing internal control reporter plasmid (pRL-TK) was co-transfected to adjust for transfection efficiency.

10 Statistical analyses

Experiments were performed in at least three independent replicates and expressed as means ± standard deviation. The Student’s t-test or one-way analysis of variance was employed for comparative assessments, with a p-value of < 0.05 indicating statistical significance. Statistical analyses were conducted using GraphPad Prism.

Results

Brachyury is significantly upregulated in CRC

The tissue microarray analysis of Brachyury expression revealed that its levels were higher in CRC tissues than in normal tissues (Fig. 1A–B).

Fig. 1
figure 1

BRY expression is markedly increased in CRC. (A–B) BRY expression in CRC vs. normal tissue (n = 46 per group, scale bar: 50 μm). BRY: Brachyury. Data are shown as means ± SD; ***p < 0.001; Student’s t-test

Full size image

Brachyury knockdown decreases CRC cell proliferation and migration

To delineate the function of Brachyury in CRC progression, we first knocked down Brachyury in HCT116 and SW480 CRC cells using siRNA (si-BRY), which reduced Brachyury mRNA and protein levels when compared with the controls (Fig. 2A–B). Functional assays revealed a marked suppression of cell proliferation (Fig. 2C–D), and significantly reduced colony formation (Fig. 2E–F). Transwell assays revealed that si-Brachyury led to a marked reduction in HCT116 and SW480 cell migration (Fig. 2G–H). This suggests that Brachyury is crucial for promoting CRC cell growth and migration.

Fig. 2
figure 2

BRY suppression reduces HCT116 and SW480 cell proliferation and migration. (A) qRT-PCR analysis (n = 3) of BRY expression in HCT116 and SW480 cells transfected with anti-BRY siRNAs (si-BRY-1# or si-BRY-2#) or control siRNA (si-NC). (B) Western blot analysis of BRY expression in HCT116 and SW480 cells transfected with si-NC, si-BRY-1#, or si-BRY-2#. Similar results were observed from three independent experiments. (C–D) CCK-8 analysis of HCT116 (C) and SW480 (D) CRC cells (n = 6). (E) Colony formation analysis of the proliferation of si-BRY-transfected CRC cells (n = 3). (F) Quantitative analysis of (E). (G) Transwell assays on CRC cells (n = 3, scale bar: 100 μm). (H) Quantitative analysis of (G). Data are shown as means ± SD; **p < 0.01, ***p < 0.001; one-way ANOVA

Full size image

Brachyury overexpression increases CRC cell proliferation and migration in vitro

Next, we overexpressed Brachyury in HCT116 and SW480 cells (Fig. 3A). The CCK-8 and Colony formation assays revealed that Brachyury overexpression significantly enhanced cell proliferation (Fig. 3B–C) and colony numbers (Fig. 3D–E), respectively. Moreover, Brachyury overexpression led to a marked elevation of HCT116 and SW480 cell migration (Fig. 3F–G). These results indicate that elevated Brachyury expression contributes to the regulation of HCT116 and SW480 cell proliferation and migration.

Fig. 3
figure 3

BRY overexpression promotes CRC cell proliferation and migration in vitro. (A) Western blot analysis of BRY expression in HCT116 and SW480 cells transfected with empty vector (EV) and OE-BRY plasmids. Similar results were observed from three independent experiments. (B–C) CCK-8 analysis of EV and OE-BRY plasmid-transfected CRC cells (n = 6). (D) Colony formation analysis of OE-BRY plasmid-transfected CRC cells (n = 3). (E) Quantitative analysis of (D). (F) Transwell assays on CRC cells (scale bar: 100 μm, n = 3). (G) Quantitative analysis of (F). Data are shown as means ± SD; *p < 0.05, **p < 0.01, ***p < 0.001; Student’s t-test

Full size image

Silencing brachyury suppresses CRC cell proliferation in vivo

To explore Brachyury function in vivo, HCT116 cells stably transfected with sh-Brachyury or an empty vector were injected into nude mice, and tumor sizes were measured at three-day intervals. This analysis revealed that the group treated with sh-Brachyury had markedly smaller subcutaneous tumors when compared with the control group (Fig. 4A–D). Immunofluorescence analysis of Ki-67 levels was used to assess Brachyury’s influence on cell proliferation in vivo. This analysis revealed that Ki-67-positive cells were markedly reduced in tumor tissues lacking Brachyury (Fig. 4E–F), suggesting that Brachyury suppression inhibits CRC cell proliferation in xenograft tumors.

Fig. 4
figure 4

BRY silencing inhibited HCT116 cell proliferation in vivo. (A) Subcutaneous tumor volumes in nude mice were measured at three-day intervals following injection (n = 5). (B) After 12 days, the tumors were harvested and photographed using a smartphone. (C) Tumor weights from the empty vector and sh-BRY groups were measured (n = 5). (D) Western blot analysis of BRY expression in the empty vector and sh-BRY groups. Similar results were observed from three independent experiments. (E) Immunofluorescence analysis of Ki-67 expression in the empty vector and sh-BRY groups (scale bar: 50 μm, n = 5). (F) Quantitative analysis of (E). Data are shown as means ± SD; *p < 0.05, **p < 0.01; Student’s t-test

Full size image

Brachyury interacts with the MMP14 promoter

We previously reported that Brachyury serves as a crucial transcriptional regulator and exerts oncogenic effects in breast cancer by directly interacting with the SOX5 promoter region [31]. Here, analysis of previous ChIP-seq data [31] revealed a prominent Brachyury-binding peak in MMP14’s promoter region (Fig. 5A). Further bioinformatic analysis identified the functional motif, 5’-CTGNAGCTTCCTACCTGRCC-3’, which is highly conserved across species (Fig. 5B). Real-time PCR analysis revealed decreased MMP14 expression in CRC cells transfected with si-Brachyury-1# and si-Brachyury-2# when compared with cells transfected with si-NC (Fig. 5C). Conversely, Brachyury overexpression significantly enhanced MMP14 expression when compared with the controls (Fig. 5D). To validate these results, ChIP-qPCR assays were used to verify Brachyury’s presence at the MMP14 promoter region. As anticipated, this transcription factor precipitated the Brachyury-bound peak sequence in CRC cells (Fig. 5E). Finally, we used a dual-luciferase reporter to assess Brachyury’s regulatory effect on the MMP14 promoter and observed that relative luciferase activity (MMP14) was significantly enhanced in HCT116 and SW480 cells co-transfected with the pGL6-MMP14 luciferase reporter vector and pcDNA3.1-Flag-Brachyury (Fig. 5F–G). In contrast, the mutated MMP14 promoter, which lacks the motif, significantly reduced Brachyury-induced MMP14 transcriptional activation (Fig. 5F–G). These results suggest that Brachyury enhances CRC cell proliferation and migration by regulating MMP14.

Fig. 5
figure 5

BRY upregulates MMP14 transcription. (A) BRY’s peak binding site in the MMP14 promoter region. (B) Sequence analysis of the putative BRY-binding region in the MMP14 gene. (C) Relative MMP14 expression in cells transfected with siRNAs (si-NC, si-BRY-1#, and si-BRY-2#) (n = 3). (D) Relative MMP14 expression in cells transfected with the empty vector (EV) or OE-BRY plasmids (n = 3). (E) BRY ChIP analysis of relative MMP14 levels in CRC cells (n = 4). (F–G) Relative luciferase activity in CRC cells transfected with pGL6-EV, pGL6-MMP14-WT, and pGL6-MMP14-MUT for 48 h (n = 4). Data are shown as means ± SD; *p < 0.05, **p < 0.01, ***p < 0.001; n.s., not significant. Student’s t-test (D); one-way ANOVA (C, E, F, G)

Full size image

MMP14 is required for CRC progression

To investigate the potential role of MMP14 in CRC progression, we used siRNA to knock down MMP14 in HCT116 and SW480 cells, which resulted in a marked decrease in MMP14 mRNA and protein levels when compared with the control groups (Fig. 6A–B). Functional assays and further analyses revealed significant suppression of cell proliferation, as confirmed by the CCK-8 assay (Fig. 6C–D), as well as a substantial reduction in colony formation capacity (Fig. 6E–F). Transwell assays revealed a significant decrease in HCT116 and SW480 cell migration after MMP14 silencing (Fig. 6G–H). Moreover, gain-of-function experiments revealed that OE-MMP14 plasmid-mediated MMP14 overexpression markedly enhanced CRC cell proliferation and migration in vitro (Fig. 7).

Fig. 6
figure 6

Suppressing MMP14 expression decreased HCT116 and SW480 cell proliferation and migration. (A) qRT-PCR analysis of MMP14 expression in HCT116 and SW480 cells transfected with siRNAs (si-NC, si-MMP14-1#, and si-MMP14-2#) (n = 3). (B) Western blot analysis of MMP14 expression in HCT116 and SW480 cells transfected with si-MMP14-1#, si-MMP14-2#, and si-NC. Similar results were observed from three independent experiments. (C–D) CCK-8 assays after MMP14 knockdown (n = 6). (E) Colony formation analysis of the proliferation of si-MMP14-transfected CRC cells (n = 3). (F) Quantitative analysis of (E). (G) Transwell analysis after si-MMP14 transfection (scale bar: 100 μm, n = 3). (H) Quantitative analysis of (G). Data are shown as means ± SD; *p < 0.05, **p < 0.01, ***p < 0.001; one-way ANOVA

Full size image
Fig. 7
figure 7

MMP14 overexpression promoted CRC cell proliferation and migration. (A) Western blot analysis of MMP14 expression in HCT116 and SW480 cells transfected with EV and OE-MMP14 plasmids. Similar results were observed from three independent experiments. (B–C) CCK-8 analysis of cells transfected with EV and OE-MMP14 plasmids (n = 6). (D) Colony formation analysis of cells transfected with EV and OE-MMP14 plasmids (n = 3). (E) Quantitative analysis of (D). (F) Transwell analysis of cells transfected with OE-MMP14 plasmids (scale bar: 100 μm, n = 3). (G) Quantitative analysis of (F). Data are shown as means ± SD; *p < 0.05, ***p < 0.001; Student’s t-test

Full size image

Brachyury promotes CRC progression by enhancing MMP14 expression

To explore the possibility that Brachyury enhances CRC progression via MMP14 upregulation, we conducted a rescue experiment and examined changes in CRC cell proliferation and migration. The si-MMP14 and OE-BRY plasmid were co-transfected into SW480 and HCT116 cells. This analysis revealed that the OE-BRY plasmid alone enhanced proliferation (Fig. 8A–B), colony formation (Fig. 8C–D), and migration (Fig. 8E–F) of both cell types, but these effects were suppressed by co-transfection with si-MMP14 (Fig. 8). On the contrary, si-Brachyury efficiently suppressed CRC cell proliferation (Fig. 9A–B), colony formation (Fig. 9C–D), and migration (Fig. 9E–F), and si-BRY’s impact was significantly mitigated by OE-MMP14 (Fig. 9). Overall, these results indicate that the Brachyury/MMP14 axis is essential for CRC progression.

Fig. 8
figure 8

MMP14 silencing mitigates BRY overexpression in CRC cells. (A–B) CCK-8 analysis after co-transfecting cells with the OE-BRY plasmid and si-MMP14 (n = 6). (C) Colony formation analysis after co-transfecting cells with the OE-BRY plasmid and si-MMP14 (n = 3). (D) Quantitative analysis of (C). (E) Transwell analysis after co-transfecting cells with the OE-BRY plasmid and si-MMP14 (scale bar: 100 μm, n = 3). (F) Quantitative analysis of (E). Data are shown as means ± SD; **p < 0.01, ***p < 0.001; one-way ANOVA

Full size image
Fig. 9
figure 9

MMP14 overexpression counteracts the impact of BRY knockdown in CRC cells. (A–B) CCK-8 analysis after co-transfecting cells with si-BRY and the OE-MMP14 plasmid (n = 6). (C) Colony formation analysis after co-transfecting cells with si-BRY and the OE-MMP14 plasmid (n = 3). (D) Quantitative analysis of (C). (E) Transwell assays after co-transfecting cells with si-BRY and OE-MMP14 plasmids (scale bar: 100 μm, n = 3). (F) Quantitative analysis of (E). Data are shown as means ± SD; *p < 0.05, **p < 0.01, ***p < 0.001; one-way ANOVA

Full size image

Discussion

CRC, a gastrointestinal malignancy, is among the most prevalent malignant neoplasms worldwide. The transcription factor Brachyury, which is characterized by a DNA-binding T-domain, orchestrates the development of the posterior mesoderm and notochord via interaction with a palindromic consensus sequence universally conserved in diverse species [6]. Several studies have shown that Brachyury is pivotal for the progression of various cancers. For instance, Brachyury inhibition affects the activity of E2F3, leading to reduced breast cancer cell proliferation and migration [32]. Brachyury also enhances the proliferation and migration of hepatocellular carcinoma cells by promoting NCAPG2 transcription [33]. Furthermore, Brachyury is also reported to promote prostate and oral cancer advancement and aggressiveness [9, 34]. Recent research has revealed that increased Brachyury expression in CRC correlates with higher tumor stage and grade, lymph node metastasis, and worse prognosis in early-stage cases [6, 16]. However, the mechanisms by which Brachyury regulates CRC progression are not fully understood.

This study highlights the effects of Brachyury knockdown on the proliferation of HCT116 and SW480 CRC cells in vitro and in vivo. Moreover, using the Transwell assay, we investigated Brachyury’s involvement in the migration of HCT116 and SW480 CRC cells and observed reduced migration rates in Brachyury-lacking cells, suggesting its potential role in promoting CRC metastasis and tumor growth.

To elucidate Brachyury’s potential mechanisms of action, we reanalyzed the Brachyury-interacting DNA regions we previously identified using ChIP-seq [31]. Importantly, we observed that silencing Brachyury markedly reduced MMP14 levels, while its overexpression had the opposite effect. Moreover, the conserved Brachyury-binding motif, 5’-CTGNAGCTTCCTACCTGRCC-3’, was found within the MMP14 promoter. Next, we created constructs with an MMP14 promoter sequence without the specific motif and utilized a dual-luciferase reporter assay. This analysis revealed that the mutant MMP14 promoter was associated with a significant inhibition of Brachyury-induced MMP14 transcriptional activation. These findings indicate that MMP14 is a direct Brachyury target and suggest a regulatory relationship whereby Brachyury influences MMP14 expression or activity.

MMP14, also known as MT1-MMP, is a crucial member of the matrix metalloproteinase family and it plays a significant role in tissue remodeling ECM component degradation [35]. Elevated MMP14 levels have been implicated in several tumorigenic mechanisms, notably including blood vessel dysfunction and impaired cytotoxic T-cell infiltration, which are pivotal for antitumor immunological defense [16, 36]. In CRC, Hes1 mRNA correlates with poor prognosis and regulates cell invasion through the STAT3–MMP14 pathway [37]. The regulatory dynamics of MMP14 expression are multifaceted and they include enhancement by transcription factors like Sp1 and Egr-1 and microRNA-mediated suppression, including by miRNA-9, miRNA − 133a, and miRNA-181a-5p [38]. Hsa_circ_0053277 promotes CRC cell growth, migration, and epithelial–mesenchymal transition via MMP14 upregulation. Conversely, miR-2467-3p inhibits these processes via MMP14 downregulation [18]. Here, we show that Brachyury influences CRC cell growth and migration via the MMP14 signaling pathway, thereby highlighting the Brachyury/MMP14 axis as a potential CRC diagnostic biomarker.

Conclusions

Our in vivo and in vitro studies highlight Brachyury’s influence on CRC cell proliferation and migration. Our findings underscore Brachyury’s potential regulatory role in MMP14 expression. Our results are the first to show that Brachyury promotes CRC progression by regulating MMP14 transcription.

Data availability

No datasets were generated or analysed during the current study.

References

  1. Dekker E, Tanis PJ, Vleugels JLA, Kasi PM, Wallace MB. Colorectal cancer. Lancet (London England). 2019;394(10207):1467–80.

    PubMed  Google Scholar 

  2. Zhou N, Guo C, Du J, Zhang X, Xu Q, Zheng X, Tu L. TSC22D2 regulates ACOT8 to delay the malignant progression of colorectal Cancer. OncoTargets Therapy. 2024;17:171–80.

    PubMed  PubMed Central  Google Scholar 

  3. Gmeiner WH. Recent advances in therapeutic strategies to improve colorectal Cancer treatment. Cancers 2024, 16(5).

  4. Thanikachalam K, Khan G. Colorectal Cancer and nutrition. Nutrients 2019, 11(1).

  5. Qiu MZ, Pan WT, Lin JZ, Wang ZX, Pan ZZ, Wang FH, Yang DJ, Xu RH. Comparison of survival between right-sided and left-sided colon cancer in different situations. Cancer Med. 2018;7(4):1141–50.

    PubMed  PubMed Central  Google Scholar 

  6. Chen M, Wu Y, Zhang H, Li S, Zhou J, Shen J. The roles of embryonic transcription factor BRACHYURY in tumorigenesis and progression. Front Oncol. 2020;10:961.

    PubMed  PubMed Central  Google Scholar 

  7. Otani R, Mukasa A, Shin M, Omata M, Takayanagi S, Tanaka S, Ueki K, Saito N. Brachyury gene copy number gain and activation of the PI3K/Akt pathway: association with upregulation of oncogenic brachyury expression in skull base Chordoma. J Neurosurg. 2018;128(5):1428–37.

    CAS  PubMed  Google Scholar 

  8. Chen M, Liu J, Liang X, Huang Y, Yang Z, Lu P, Shen J, Shi K, Qu H. Knockdown of brachyury suppresses breast Cancer cell proliferation and migration via targeting E2F3. J Oncol. 2022;2022:7913067.

    PubMed  PubMed Central  Google Scholar 

  9. Pinto F, Pértega-Gomes N, Pereira MS, Vizcaíno JR, Monteiro P, Henrique RM, Baltazar F, Andrade RP, Reis RM. T-box transcription factor brachyury is associated with prostate cancer progression and aggressiveness. Clin cancer Research: Official J Am Association Cancer Res. 2014;20(18):4949–61.

    CAS  Google Scholar 

  10. Yamaki H, Kono M, Wakisaka R, Komatsuda H, Kumai T, Hayashi R, Sato R, Nagato T, Ohkuri T, Kosaka A, et al. Brachyury-targeted immunotherapy combined with gemcitabine against head and neck cancer. Cancer Immunol Immunotherapy: CII. 2023;72(8):2799–812.

    CAS  PubMed  PubMed Central  Google Scholar 

  11. Kilic N, Feldhaus S, Kilic E, Tennstedt P, Wicklein D, Wasielewski R, Viebahn C, Kreipe H, Schumacher U. Brachyury expression predicts poor prognosis at early stages of colorectal cancer. Eur J cancer (Oxford England: 1990). 2011;47(7):1080–5.

    Google Scholar 

  12. Makutani Y, Kawakami H, Tsujikawa T, Yoshimura K, Chiba Y, Ito A, Kawamura J, Haratani K, Nakagawa K. Contribution of MMP14-expressing cancer-associated fibroblasts in the tumor immune microenvironment to progression of colorectal cancer. Front Oncol. 2022;12:956270.

    CAS  PubMed  PubMed Central  Google Scholar 

  13. Hawinkels LJ, Kuiper P, Wiercinska E, Verspaget HW, Liu Z, Pardali E, Sier CF. Ten Dijke P: matrix metalloproteinase-14 (MT1-MMP)-mediated endoglin shedding inhibits tumor angiogenesis. Cancer Res. 2010;70(10):4141–50.

    CAS  PubMed  Google Scholar 

  14. Niland S, Riscanevo AX, Eble JA. Matrix metalloproteinases shape the tumor microenvironment in Cancer progression. Int J Mol Sci 2021, 23(1).

  15. Yu J, He Z, He X, Luo Z, Lian L, Wu B, Lan P, Chen H. Comprehensive analysis of the expression and prognosis for MMPs in human colorectal Cancer. Front Oncol. 2021;11:771099.

    CAS  PubMed  PubMed Central  Google Scholar 

  16. Claesson-Welsh L. How the matrix metalloproteinase MMP14 contributes to the progression of colorectal cancer. J Clin Investig. 2020;130(3):1093–5.

    CAS  PubMed  PubMed Central  Google Scholar 

  17. Cui G, Cai F, Ding Z, Gao L. MMP14 predicts a poor prognosis in patients with colorectal cancer. Hum Pathol. 2019;83:36–42.

    CAS  PubMed  Google Scholar 

  18. Xiao H, Liu M. Circular RNA Hsa_circ_0053277 promotes the development of colorectal cancer by upregulating matrix metallopeptidase 14 via miR-2467-3p sequestration. J Cell Physiol. 2020;235(3):2881–90.

    CAS  PubMed  Google Scholar 

  19. Qi Y, Jiang M, Yuan Y, Bi Y, Zheng B, Guo X, Huang X, Zhou Z, Sha J. ADP-ribosylation factor-like 3, a manchette-associated protein, is essential for mouse spermiogenesis. Mol Hum Reprod. 2013;19(5):327–35.

    CAS  PubMed  Google Scholar 

  20. Wu Y, Wang T, Zhao Z, Liu S, Shen C, Li H, Liu M, Zheng B, Yu J, Huang X. Retinoic acid induced protein 14 (Rai14) is dispensable for mouse spermatogenesis. PeerJ. 2021;9:e10847.

    PubMed  PubMed Central  Google Scholar 

  21. Shen C, Zhang K, Yu J, Guo Y, Gao T, Liu Y, Zhang X, Chen X, Yu Y, Cheng H, et al. Stromal interaction molecule 1 is required for neonatal testicular development in mice. Biochem Biophys Res Commun. 2018;504(4):909–15.

    CAS  PubMed  Google Scholar 

  22. Wu Y, Zhang R, Shen C, Xu J, Wu T, Huang X, Liu M, Li H, Xu D, Zheng B. Testis-enriched Asb15 is not required for spermatogenesis and male fertility in mice. Am J Translational Res. 2022;14(10):6978–90.

    CAS  Google Scholar 

  23. Zhang K, Xu J, Ding Y, Shen C, Lin M, Dai X, Zhou H, Huang X, Xue B, Zheng B. BMI1 promotes spermatogonia proliferation through epigenetic repression of Ptprm. Biochem Biophys Res Commun. 2021;583:169–77.

    CAS  PubMed  Google Scholar 

  24. Zhou J, Li J, Qian C, Qiu F, Shen Q, Tong R, Yang Q, Xu J, Zheng B, Lv J, et al. LINC00624/TEX10/NF-κB axis promotes proliferation and migration of human prostate cancer cells. Biochem Biophys Res Commun. 2022;601:1–8.

    CAS  PubMed  Google Scholar 

  25. Wang Q, Wu Y, Lin M, Wang G, Liu J, Xie M, Zheng B, Shen C, Shen J. BMI1 promotes osteosarcoma proliferation and metastasis by repressing the transcription of SIK1. Cancer Cell Int. 2022;22(1):136.

    CAS  PubMed  PubMed Central  Google Scholar 

  26. Wu L, Li S, Xu J, Shen C, Qian Q. AGAP2-AS1/BRD7/c-Myc signaling axis promotes skin cutaneous melanoma progression. Am J Transl Res. 2023;15(1):350–62.

    CAS  PubMed  PubMed Central  Google Scholar 

  27. Liu Y, Yu X, Huang A, Zhang X, Wang Y, Geng W, Xu R, Li S, He H, Zheng B, et al. INTS7-ABCD3 interaction stimulates the proliferation and osteoblastic differentiation of mouse bone marrow mesenchymal stem cells by suppressing oxidative stress. Front Physiol. 2021;12:758607.

    PubMed  PubMed Central  Google Scholar 

  28. Chen X, Zheng Y, Han Y, He H, Lv J, Yu J, Li H, Hou S, Shen C, Zheng B. SAT2 regulates Sertoli cell-germline interactions via STIM1-mediated ROS/WNT/β-catenin signaling pathway. Cell Biol Int. 2022;46(10):1704–13.

    CAS  PubMed  Google Scholar 

  29. Yu J, Wu Y, Li H, Zhou H, Shen C, Gao T, Lin M, Dai X, Ou J, Liu M, et al. BMI1 drives steroidogenesis through epigenetically repressing the p38 MAPK pathway. Front Cell Dev Biology. 2021;9:665089.

    Google Scholar 

  30. Liu JY, Jiang YN, Huang H, Xu JF, Wu YH, Wang Q, Zhu Y, Zheng B, Shen C, Qian WF, et al. BMI-1 promotes breast cancer proliferation and metastasis through different mechanisms in different subtypes. Cancer Sci. 2023;114(2):449–62.

    CAS  PubMed  Google Scholar 

  31. Chen M, Zou S, He C, Zhou J, Li S, Shen M, Cheng R, Wang D, Zou T, Yan X, et al. Transactivation of SOX5 by brachyury promotes breast cancer bone metastasis. Carcinogenesis. 2020;41(5):551–60.

    CAS  PubMed  Google Scholar 

  32. Chen M, Liu J, Liang X, Huang Y, Yang Z, Lu P, Shen J, Shi K, Qu H, Izadpanah R. Knockdown of brachyury suppresses breast Cancer cell proliferation and migration via targeting E2F3. J Oncol. 2022;2022:1–11.

    Google Scholar 

  33. Li S, Lu Y, Xu Y, Zhang C, Liu B, Qin A, Qiao Z, Shen C, Shen J, Liang Y, et al. Brachyury promotes proliferation and migration of hepatocellular carcinoma via facilitating the transcription of NCAPG2. Am J cancer Res. 2022;12(8):3625–43.

    CAS  PubMed  PubMed Central  Google Scholar 

  34. Akimoto N, Nakamura K, Hijioka H, Kume K, Matsumura Y, Sugiura T. Transfection of T-Box transcription factor BRACHYURY and SOX2 synergistically promote Self-Renewal and invasive phenotype in oral Cancer cells. Int J Mol Sci 2018, 19(11).

  35. Gonzalez-Molina J, Gramolelli S, Liao Z, Carlson JW, Ojala PM, Lehti K. MMP14 in sarcoma: A regulator of tumor microenvironment communication in connective tissues. Cells 2019, 8(9).

  36. Wu J, Guo Y, Zuo ZF, Zhu ZW, Han L. MMP14 is a diagnostic gene of intrahepatic cholangiocarcinoma associated with immune cell infiltration. World J Gastroenterol. 2023;29(19):2961–78.

    CAS  PubMed  PubMed Central  Google Scholar 

  37. Weng MT, Tsao PN, Lin HL, Tung CC, Change MC, Chang YT, Wong JM, Wei SC. Hes1 increases the invasion ability of colorectal Cancer cells via the STAT3-MMP14 pathway. PLoS ONE. 2015;10(12):e0144322.

    CAS  PubMed  PubMed Central  Google Scholar 

  38. Li Y, Kuscu C, Banach A, Zhang Q, Pulkoski-Gross A, Kim D, Liu J, Roth E, Li E, Shroyer KR, et al. miR-181a-5p inhibits Cancer cell migration and angiogenesis via downregulation of matrix Metalloproteinase-14. Cancer Res. 2015;75(13):2674–85.

    CAS  PubMed  PubMed Central  Google Scholar 

Download references

Acknowledgements

We are grateful to Charlesworth (https://www.cwauthors.com.cn/) for their assistance in editing a draft of this manuscript.

Funding

This work was supported by the scientific research project of the Wuxi Health Commission (Grant No. Q202328). No benefits in any form have been or will be received from a commercial party directly or indirectly related to the subject of this manuscript.

Author information

Author notes

  1. Ming Chen, Huiheng Qu and Xiao Liang contributed equally to this work.

Authors and Affiliations

  1. Department of Orthopeadic Surgery, The Affiliated Wuxi No. 2 People’s Hospital of Nanjing Medical University, Wuxi, 214000, China

    Ming Chen, Zhengjie Yang, Pei Lu, Keqin Shi, Peng Chen & Yanjing Zhang

  2. Department of General Surgery, The Affiliated Wuxi No. 2 People’s Hospital of Nanjing Medical University, Wuxi, 214000, China

    Huiheng Qu & Jiazeng Xia

  3. Department of Anesthesiology, The Affiliated Wuxi No. 2 People’s Hospital of Nanjing Medical University, Wuxi, 214000, China

    Xiao Liang

  4. Department of Ultrasonography, The Fifth People’s Hospital of Suzhou, Suzhou, 215002, China

    Ying Huang

  5. Human Reproductive and Genetic Center, Affiliated Hospital of Jiangnan University, Wuxi, 214122, China

    Hui Zhou

  6. Department of Orthopeadic Surgery, Suzhou Municipal Hospital, the Affiliated Suzhou Hospital of Nanjing Medical University, Suzhou, 215002, China

    Jun Shen

Authors
  1. Ming Chen
    View author publications

    You can also search for this author inPubMed Google Scholar

  2. Huiheng Qu
    View author publications

    You can also search for this author inPubMed Google Scholar

  3. Xiao Liang
    View author publications

    You can also search for this author inPubMed Google Scholar

  4. Ying Huang
    View author publications

    You can also search for this author inPubMed Google Scholar

  5. Zhengjie Yang
    View author publications

    You can also search for this author inPubMed Google Scholar

  6. Pei Lu
    View author publications

    You can also search for this author inPubMed Google Scholar

  7. Keqin Shi
    View author publications

    You can also search for this author inPubMed Google Scholar

  8. Peng Chen
    View author publications

    You can also search for this author inPubMed Google Scholar

  9. Yanjing Zhang
    View author publications

    You can also search for this author inPubMed Google Scholar

  10. Hui Zhou
    View author publications

    You can also search for this author inPubMed Google Scholar

  11. Jiazeng Xia
    View author publications

    You can also search for this author inPubMed Google Scholar

  12. Jun Shen
    View author publications

    You can also search for this author inPubMed Google Scholar

Contributions

MC, HHQ, JZX and JS contributed to the study conception and design. All authors collected the data and performed the data analysis. All authors contributed to the interpretation of the data and the completion of figures and tables. All authors contributed to the drafting of the article and final approval of the submitted version.

Corresponding authors

Correspondence to Hui Zhou, Jiazeng Xia or Jun Shen.

Ethics declarations

Ethics approval and consent to participate

Animal experiment protocols were approved by the Research Committee of Wuxi No.2 People’s Hospital, affiliated with Nanjing Medical University.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Additional information

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Supplementary Material 1

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Chen, M., Qu, H., Liang, X. et al. Brachyury promotes proliferation and migration of colorectal cancer cells by targeting MMP14. Cancer Cell Int 25, 132 (2025). https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s12935-025-03726-w

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s12935-025-03726-w

Keywords

Cancer Cell International

ISSN: 1475-2867

Contact us